Ganoderma lucidum

Condividi l'articolo di Microbiologia Italia:

Caratteristiche

Ganoderma lucidum è un fungo parassita, saprofita e medicinale appartenente al phylum dei Basidiomiceti e contenente una miriade di composti bioattivi che lo rendono una delle sostanze terapeutiche naturali più efficaci disponibili. È distribuito a livello globale, dalle regioni tropicali a quelle subtropicali grazie alla sua preferenza per i luoghi caldi e umidi, prolifera sui rami e i tronchi in putrefazione di castagno, quercia, faggio, olmo, acero e altri alberi dalle foglie larghe (latifoglie). Il suo sviluppo avviene in ogni stagione eccetto in inverno, anche se predilige i periodi più afosi. Nel mondo occidente è conosciuto col nome Reishi, derivato dal giapponese, mentre nell’antica Cina era chiamato Ling Zhi, ovvero “pianta dello spirito”. Poiché si pensa che allunghi la durata della vita, è stato indicato con i seguenti appellativi: “fungo dei mille anni”, “fungo della potenza spirituale” e “fungo dell’immortalità”.

Questo micete si presenta con un aspetto luminoso e smaltato, è distinto da un cappello reniforme sul quale si formano delle spore che gli fanno assumere la sembianza della carta vetrata. Di per sé non è un fungo mangereccio a causa del sapore amarognolo e la consistenza fibrosa.

Figura 1 – Ganoderma lucidum
Figura 1 – Ganoderma lucidum [grocycle.com  /  ashevillefungi.com]

La tassonomia del micete è legata all’introduzione del genere Ganoderma da parte del micologo finlandese Petter Adolf Karsten nel 1881; un secolo prima il botanico inglese William Curtis aveva attribuito al fungo il primo nome binomiale, cioè Boletus lucidus. Il nome scientifico ha origini greche e latine: la parola Ganoderma deriva dal greco “ganos” (luminosità) e “derma” (pelle), mentre il termine “lucidum” viene dal latino “brillante”.

Nel 1889 il micologo e farmacista francese Narcisse Thèodore Patrouillard aggiornò il genere introdotto da Karsten al fine di includere tutte le specie caratterizzate dalle spore pigmentate, i tubuli aderenti al gambo e il cappello lucido; dalla sua revisione risultarono un totale di 48 specie classificate sotto il genere Ganoderma.

Uno sguardo alla storia e alla leggenda

La storia di questo micete è comprovata nella Medicina Tradizionale Cinese e Giapponese da oltre due millenni, malgrado, secondo alcuni indizi, il suo impiego sia datato a più di 4000 anni fa. In un volume di erbologia cinese risalente al 1578, il Pen T’sao Kang Mu (Compendio di Materia Medica), il compilatore descrive il Reishi in questo modo: “Influisce positivamente sull’energia vitale, sul Qi del cuore, curando l’area del petto e giovando a coloro che hanno i muscoli del torace contratti. Assunto per molto tempo, l’agilità del corpo cesserà, e negli anni si allungheranno come quelli degli Esseri Immortali”.

È interessante narrare in maniera sintetica la leggenda del Reishi, secondo cui le prime persone a cimentarsi con questo fungo furono i sacerdoti taoisti del primo secolo d. C., tra i quali G. lucidum raffigurava un componente di pozioni magiche che garantivano la longevità, l’eterna gioventù e l’immortalità. In quell’era questi sacerdoti si dedicavano all’alchimia ed erano reputati maghi o stregoni. Il filosofo Wang Chong (25-100 d. C.), della dinastia Han, compose una poesia in cui espose l’impiego dei funghi da parte dei preti taoisti allo scopo di ascendere a uno stato superiore di coscienza. Mettiamo qui un pezzo del componimento:

Prendono dosi di germi d’oro e di giada
e mangiano il frutto migliore del purpureo fungo poliporo.
Cibandosi di ciò che è germinale, i loro corpi diventano lievi,
ed essi sono capaci di trascendenza spirituale.

Nel “Classico sulle Radici di Erbe del Contadino Divino” (200 d. C.), il più antico trattato medico della Cina, il G. lucidum occupa una posizione encomiabile: l’opera definisce 365 ingredienti, che vengono classificati in tre gruppi, ovvero superiori, medi e accettabili. Affinché un componente possa essere compreso nella categoria più alta, è necessario che possegga delle proprietà medicinali valide e non provochi reazioni dannose o collaterali quando la somministrazione è prolungata. Il Reishi è collocato nella prima tipologia, in cima alla lista, prima del ginseng, ed è descritto come un fungo dalla gustosità acre, dall’energia atmosferica neutra e dalla mancanza di tossicità. È terapeutico verso l’accumulamento di agenti patogeni nel torace, è benefico per il quoziente intellettivo e i processi mentali, ha un effetto rinforzante sulla milza, incrementa la saggezza e affina la memoria. In aggiunta a ciò, fa vivere più a lungo e permette lo sviluppo dello spirito.

Circa 23 secoli fa, l’imperatore Ti della dinastia Chen venne a conoscenza della reputazione di G. lucidum come “fungo dell’immortalità”, realizzò una flotta di navi gestite da 300 uomini poderosi e 300 donne avvenenti, e dispose che le navi si avviassero verso Oriente (in quanto si credeva che il fungo si trovasse lì) e tornare con il fungo. Durante il viaggio si scatenò una tempesta, e i naufraghi giunsero su un’isola, dove crearono una nuova nazione. Secondo la leggenda, quest’isola è il Giappone.

Nell’arte cinese il Reishi simboleggia la buona salute e la lunga vita; è possibile trovare immagini del micete sulle porte, sulle architravi, sulle arcate e sulle ringhiere di tutte le abitazioni imperiali nella Città Proibita e nel Palazzo d’Estate. Sovente la storia narra che un G. lucidum è intagliato nello scettro che si utilizza nelle cerimonie ufficiali; in un abito di seta dell’imperatore sono disegnati un pesco, nuvole e, in primo piano, un Reishi.

Il popolo adoperava la figura del fungo come portafortuna o talismano; si può notare che, talvolta, i soggetti presenti nei disegni a inchiostro, negli arazzi e nei dipinti, sfoggiano ornamenti o gioielli di giada che hanno la forma del Reishi. La dea cinese del risanamento e della commiserazione, Kuan Yin, alle volte è ritratta con un G. lucidum in mano. Nella celebra favola del “Serpente Bianco” alcuni opinano che questo micete sia la pianta della resurrezione; la fiaba narra che la Dama Bianca intraprende un itinerario fino al monte Kunlun, con l’obiettivo di trovare la pianta e fare in modo che il marito torni in vita. In seguito alla manifestazione del suo amore per il coniuge, ella riesce a guadagnarsi il fungo e l’uomo resuscita.

Filogenesi

Dominio              Eukaryota

Regno                  Fungi

Phylum                Basidiomycota

Classe                  Agaricomycetes

Ordine                 Polyporales

Famiglia              Ganodermataceae

Genere                Ganoderma

Specie                  Ganoderma lucidum

Morfologia e ciclo vitale

I corpi fruttiferi di G. lucidum (cappelli o pilei) esibiscono solitamente una forma somigliante a un rene o a un ventaglio, una superficie lucida-laccata cosparsa di striature concentriche, un pigmento che va dal rosso al rossastro-marrone, con o senza i margini bianchi e gialli brillanti quando arrivano allo stadio maturo (Fig. 1). I tubuli sono profondi fino a 2 cm, di un colore bruno che ricorda quello dei lividi e contengono dei pori bianchi di 0,1 cm. Il fusto è marrone scuro, cilindrico, liscio, lungo da 3 a 12 cm e largo 1-2 cm. In alcuni casi il gambo è assente e i corpi fruttiferi sono attaccati alla base di un albero (Fig. 2). La polpa è elastica e legnosa. Le basidiospore sono giallastre-marroni, dotate di una doppia membrana, ellissoidi, con la cima piatta od ovale e una base rotonda, e le dimensioni variano da 6,24-9,08 μm x 9,11-12 μm (Fig. 3).

Figura 2 – Corpo fruttifero del G. lucidum direttamente attaccato all’albero, senza il fusto
Figura 2 – Corpo fruttifero del G. lucidum direttamente attaccato all’albero, senza il fusto [Autore: Vanessa Vitali / erbecurative.altervista.org]
Figura 3 – Spore di G. lucidum
Figura 3 – Spore di G. lucidum [bioweb.uwlax.edu]

In estate e autunno i corpi fruttiferi del Reishi liberano nell’aria milioni di spore, che vengono trasportate verso nuovi siti e, in condizioni favorevoli, germinano e creano l’ifa primaria. Affinché la crescita prosegua, è necessario un processo di fecondazione chiamato plasmogamia, che è comparabile alla fusione dello spermatozoo e l’ovulo, anche se nei funghi non si verifica l’unione dei nuclei dei gameti come negli animali. In questo caso i citoplasmi delle due cellule si associano generando una cellula dicarionte (con due nuclei aploidi). A questo punto avviene la creazione dell’ifa secondaria, che esprime un enzima che provvede alla disintegrazione del legno, l’idrolasi; fino a quando la quantità del legno è sufficiente, l’ifa secondaria può continuare a proliferare per molti anni. Le ife neoformate si ramificano per aumentare la superficie di assorbimento dei nutrienti, e combinate insieme conducono allo sviluppo del micelio

Nel momento in cui le circostanze diventano inadeguate per la crescita ottimale, il fungo deve produrre un corpo fruttifero che consente di rilasciare le spore sessuate, le quali possono essere distribuite in luoghi in cui le condizioni sono più idonee. I corpi fruttiferi formano il basidio, una struttura unicellulare o pluricellulare di forma clavata o globosa, all’interno del quale si compie la cariogamia, ovvero l’associazione dei due nuclei aploidi. Il risultato è una cellula diploide che va incontro a divisione tramite meiosi, da cui si creano quattro spore aploidi, che vengono liberate all’esterno del basidio quando il processo è completo. Con il rilascio delle spore il ciclo ricomincia.  La figura 4 riassume schematicamente il ciclo vitale e il ciclo di riproduzione sessuata di G. lucidum.

Figura 4 – Ciclo biologico e ciclo di riproduzione sessuata del G. lucidum
Figura 4 – Ciclo biologico e ciclo di riproduzione sessuata di G. lucidum [northspore.com / bioweb.uwlax.edu]

G. lucidum, come anche altre specie di Ganoderma (G. destructans, G. austroafricanum, G. enigmaticum), è un parassita facoltativo che può vivere anche come saprofita traendo energia tramite la decomposizione del fusto e delle radici degli alberi. Proprio per questo motivo la sua coltivazione necessita di substrati di legno moderatamente putrefatto, e si può ricorrere a due metodiche: 1) inoculando delle spore nella pasta di legno contenuta in una bottiglia, 2) inoculando delle spore su pezzi di tronco presenti in contenitori del medesimo materiale.  

G. lucidum si comporta come un fungo patogeno inducendo il decadimento del legno con imputridimento delle radici e dei fusti nelle coltivazioni perenni e negli alberi importanti dal punto di vista economico, in particolare nei paesi tropicali. Degli esempi sono la Jacaranda mimositofila (una pianta appartenente alla famiglia delle Bignoniaceae, originaria del Sudamerica) e la Ceratonia siliqua o Cerrubo (un albero da frutto incluso nella famiglia delle Caesalpiniaceae, che cresce spontaneo nel bacino del Mediterraneo, del Marocco e Portogallo atlantici).

Al livello ecologico le specie di Ganoderma giocano un ruolo fondamentale nel disfacimento delle piante legnose per la mobilitazione dei nutrienti. Sono efficaci nella produzione della bioenergia e vengono usate nel biorisanamento, dal momento che contengono l’enzima per la decomposizione della lignocellulosa (scarti secchi derivati dai vegetali).

Metodi di identificazione

Il Reishi può essere riconosciuto ricorrendo a multiple tipologie di analisi. La prima è l’esame obiettivo basato sulla forma e il colore del cappello, sull’ecologia del micete (su quali specie di alberi si trova e in quali luoghi del mondo), sulla riproduzione (le spore vengono rilasciate dai pori presenti sulla parte inferiore del pileo o non dalle lamelle) e sul periodo dell’anno in cui crescono (dall’estate all’autunno). Se si vuole andare oltre il semplice esame obiettivo, è possibile impiegare l’indagine microscopica trattando il campione con idrossido di potassio al 5% (questa permette di osservare le caratteristiche delle spore), e quella molecolare. Quest’ultima si esegue mediante l’estrazione del DNA del micete, l’amplificazione di specifiche sequenze mediante la reazione a catena della DNA polimerasi (PCR), seguite poi dal sequenziamento e dalla valutazione bioinformatica. In un articolo pubblicato su Frontiers in Microbiology nel 2018, i ricercatori amplificarono le sequenze ITS (distanziatore interno trascritto) e Tef1α (fattore di allungamento della traduzione eucariotica 1-alfa) impiegando le rispettive coppie di oligonucleotidi: ITS1F (5’ CTTGGTCATTTAGAGGAAGTAA) e ITS4b (5’ CAGGAGACTTGTACACGGTCCAG) / EF-Gano23F (5’ GGTGTCAGGCAGCTCATYGT) e EF-Gano887R (5’ CGAACTTGCARGCGATGTG). I prossimi passaggi furono il sequenziamento con metodo di Sanger delle due sequenze ottenute tramite PCR e l’analisi bioinformatica mediante allineamento con le sequenze contenute nel database GenBank.

Componente chimica e benefici del fungo

G. lucidum contiene una notevole quantità di sostanze bioattive che comprendono triterpeni/terpenoidi, polisaccaridi, glicoproteine, nucleosidi, cerebrosidi, steroli (ergosterolo e beta-sitosterolo), steroidi, acidi grassi, peptidi/proteine, vitamine del gruppo B (in particolare l’acido folico), fibre e oligoelementi.

Facciamo una descrizione dei componenti primari;

  • Triterpeni: si tratta di molecole idrofobiche di natura steroidea, contenenti 30 atomi di carbonio, che raffigurano la parte amara del fungo (più la concentrazione di terpenoidi è elevata, più il fungo è acre) e che sono presenti sottoforma di acidi ganoderici (Fig. 5). Alcuni di questi idrocarburi ciclici (acido ganoderico A, B, C e D) sono efficaci nel trattamento delle reazioni allergiche, in quanto riducono il rilascio di istamina, permettendo l’ottimizzazione della respirazione cellulare e il supporto della funzionalità epatica. Altri (acido ganoderico M ed F), invece, abbassano i livelli di colesterolo LDL e trigliceridi. Studi preliminari hanno confermato che una concentrazione maggiore di acidi ganoderici è presente nelle spore rispetto ad altre parti del micete;
  • Polisaccaridi: tra gli zuccheri complessi sono inclusi i beta-D-glucani e gli eteropolisaccaridi di xilosio, mannosio, galattosio e acido uronico. Queste molecole hanno attività antitumorale grazie alla stimolazione del sistema immunitario e alla limitazione dell’angiogenesi;
  • Proteine: una di queste è la Ling Zhi-8 (LZ-8) che, nella sequenza e nella struttura secondaria, è simile alla regione variabile della catena pesante delle immunoglobuline. In aggiunta a ciò, possiede un’azione immunomodulante inducendo la produzione di citochine anti-infiammatorie come interleuchina 10, interleuchina 12 e interleuchina 20, stimolando la maturazione dei monociti attraverso l’attivazione delle vie di segnalazione NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) e MAPK (mitogen-activated protein kinases), aumentando l’attivazione dei linfociti T, e cambiando l’equilibrio tra linfociti T helper 1 (Th1) e linfociti T helper 2 (Th2) a favore dei Th1;
  • Acidi grassi: in questo gruppo sono inseriti l’acido palmitico, l’acido stearico, l’acido lignocerico, l’acido nonadecilico, l’acido beenico e l’acido pirofosfatidico;
  • Nucleosidi, tra cui l’adenosina, che ha effetto su vari organi: dilata le arterie coronarie, abbassa la frequenza cardiaca, accentua la sintesi e la secrezione di ormoni steroidei nelle ghiandole surrenali, funge da neurotrasmettitore sedativo e regola il sonno;
  • Negli oligoelementi, o sali minerali, rientrano il ferro, lo zinco, il rame, il potassio, il calcio, il magnesio, il manganese e il germanio organico. Quest’ultimo ha diverse proprietà, tra cui è immunostimolante, antitumorale e antivirale, poiché induce la sintesi di interferone gamma, aumenta l’attività delle cellule Natural Killer, il numero del macrofagi e dei linfociti T soppressori (per questo viene usato nella cura dell’AIDS). Inoltre, incrementa l’ausilio e la disponibilità di ossigeno alle cellule (è utile in caso di ischemia).
Figura 5 – Struttura chimica di un acido ganoderico
Figura 5 – Struttura chimica di un acido ganoderico [www.sciencedirect.com]

Considerati i molteplici composti bioattivi, il Reishi è contraddistinto da un cospicuo numero di effetti benefici sull’organismo, oltre a quelli già accennati: analgesico, antiallergico, preventivo della bronchite, antiinfiammatorio, immunostimolante, antibatterico e antivirale, antiossidante (grazie anche all’amminoacido ergotioneina, derivato dall’istidina), antitumorale, ipotensivo, ipocolesterolemizzante, cardiotonico, antidepressivo e rilassante, mucolitico, potenzia la funzionalità cortico-surrenalica, fluidifica il sangue e supporta il sistema nervoso autonomo (grazie all’acido pantotenico o vitamina B5).

Secondo alcuni studi il luogo in cui il micete prolifera raffigura un fattore importante nella determinazione del profilo e della quantità di principi attivi. Uno articolo del 2014, pubblicato su International Journal of Food and Nutrition, descrive uno studio dettagliato sulle proprietà biochimiche e bioattive di ceppi di G. lucidum provenienti da due nazioni differenti, ossia Serbia (GS) e Cina (GCN). Il GS contiene una mole di fruttosio più alta, mentre nel GCN lo zucchero più abbondante è il mannitolo. Per quanto concerne gli acidi organici, il numero maggiore è presente nel GCN, dove predominano l’acido malico, l’acido chinico e l’acido ossalico. Nel GS dominano gli acidi grassi monoinsaturi, mentre nel GCN c’è una concentrazione più alta gli acidi grassi polinsaturi; in entrambi i ceppi gli acidi grassi in quantità più cospicua sono l’acido linoleico, l’acido oleico e l’acido palmitico

Passando alle proprietà bioattive, il GCN  è risultato possedere una maggiore attività antiossidante, mentre il GS esibisce una capacità inibitoria verso le linee cellulari di carcinoma cervicale e mammario umani.  Ambedue i ceppi sono dotati di funzione antibatterica e antifungina, in alcuni casi migliore di quelle dei farmaci antimicrobici convenzionali.

Prima di concludere questa parte, sarebbe appropriato fare un accenno dei potenziali effetti collaterali di G. lucidum. Nella medicina tradizionale cinese questi micete è ritenuto un’erba superiore e di prima qualità, ossia non è dannoso per la salute, lo si può consumare per lunghi periodi e, di solito, non provoca effetti avversi. Ciononostante, ci sono circostanze in cui possono manifestarsi esiti negativi lievi, per esempio in caso di allergie ai funghi o se non si gode di buona salute. Tra questi abbiamo vertigini, disturbi della digestione, diarrea, nausea, tossicità epatica, abbassamento della pressione ematica, secchezza di naso, bocca e gola, eruzioni cutanee, prurito, epistassi (sangue dal naso) e melena (sangue nelle feci). Questi ultimi due sono connessi all’effetto anticoagulante dovuto a una proteasi che inibisce il legame trombina-fibrinogeno.

Approcci biotecnologici

Poiché G. lucidum è un fungo medicinale, la micoterapia raffigura una delle principali applicazioni. Innanzitutto, il Reishi non viene impiegato allo stato grezzo, bensì subisce un trattamento specifico allo scopo di ottenere l’estratto e la polvere. Ѐ importante rimarcare che malgrado questo fungo venga suggerito come coadiuvante di terapie composite, non è un farmaco, bensì un integratore alimentare. Per tale ragione può essere consumato a prescindere dall’età e dalle condizioni fisio-patologiche, anche se sarebbe meglio consultarsi prima col proprio medico di base, il quale valuterà e consiglierà l’eventuale assunzione. Ci sono dei casi in cui l’ingestione di G. lucidum potrebbe non essere raccomandabile, per esempio nelle persone che devono sottoporsi o che hanno affrontato un trapianto d’organo e che quindi prendono farmaci immunosoppressori.

Gli integratori a base di Reishi (Fig. 6) non sono tutti uguali, la qualità varia a seconda della coltivazione (metodologia, natura del fungo, peculiarità del legno, clima e ambiente) e da come viene eseguita l’estrazione del principio attivo. È palese affermare che il Giappone rappresenta la nazione con la più elevata esperienza e preparazione nella fabbricazione di integratori includenti questo micete; bisogna sottolineare che lì utilizzano il metodo di coltivazione naturale.

Quando si vuole acquistare un integratore a base di G. lucidum, è opportuno cercare marchi adeguatamente etichettati ed escludere prodotti di origine incerta.

Figura 6 – Integratore a base di G. lucidum
Figura 6 – Integratore a base di G. lucidum [www.avdreform.it]

Gli integratori a base di G. lucidum, contenenti l’estratto e/o la polvere del fungo, esistono in diverse forme, e qui elenchiamo alcuni esempi:

  • Cioccolato fondente con estratto di Reishi (Fig. 7A)
  • Polvere di Reishi in capsule (Fig. 7B)
  • Estratto di Reishi in capsule (Fig. 7C)
  • Polvere di Reishi pura (Fig. 7D)
Figura 7 – Integratori a base di G. lucidum in diverse forme: cioccolato fondente con estratto di Reishi (A), polvere di Reishi in capsule (B), estratto di Reishi in capsule (C), polvere di Reishi pura (D)
Figura 7 – Integratori a base di G. lucidum in diverse forme: cioccolato fondente con estratto di Reishi (A), polvere di Reishi in capsule (B), estratto di Reishi in capsule (C), polvere di Reishi pura (D) [www.funghi-vitalia.it]

Oltre alle tipologie appena descritte, ci sono ulteriori varietà di integratori a base di questo fungo, e a questo punto non possiamo fare a meno di citare Organo Gold, una famosa società di network marketing che produce tè verde, tè rosso, caffè nero, caffè latte, cioccolata calda e altri prodotti, tutti arricchiti con polvere e/o estratto di G. lucidum (Fig. 8).

Figura 8 – Tre prodotti di Organo Gold, contenenti il Reishi: tè verde (A), cioccolata calda (B) e caffè nero (C)
Figura 8 – Tre prodotti di Organo Gold, contenenti il Reishi: tè verde (A), cioccolata calda (B) e caffè nero (C) [www.organogold.com]

Il momento migliore della giornata per assumere il Reishi è la mattina, a stomaco vuoto, insieme a integratori di acido ascorbico, dal momento che la vitamina C incrementa l’assorbimento dei polisaccaridi del micete. In aggiunta a ciò, è preferibile bere una quantità d’acqua idonea per facilitare la filtrazione renale.

Comunque, è fattibile anche la consumazione di G. lucidum come alimento; a tal proposito, dopo aver raccolto il fungo, è necessario tagliarlo ed essiccarlo al fine di permettere la conservazione. In seguito, le procedure di cottura che andrebbero preferite sono la bollitura (per le zuppe) e l’infusione (per le bevande).

Qualcuno potrebbe porsi questa domanda: che differenza c’è tra gli integratori a base di G. lucidum e l’alimento/bevanda? Prevalentemente la diversità concerne la quantità di sostanze bioattive, che è più elevata negli integratori. Bisogna ricordare, però, che la concentrazione dei composti bioattivi varia a seconda della qualità degli integratori: quelli più pregiati sono realizzati sotto forma di concentrato autentico in costituenti attivi, mentre quelli più dozzinali sono prodotti mediante la semplice polverizzazione della carne essiccata e hanno livelli più bassi di principi attivi.

Fonti

  • Karsten P. A. 1881. “Enumeratio Boletinearum et Polyporearum Fennicarum, systemate novo dispositarum”, Revue Mycologique
  • Steyaert R. L. 1961. “Note on the nomenclature of fungi and, incidentally, of Ganoderma lucidum“, Taxon
  • Liddell Henry George, Scott Robert. 1980. A Greek-English Lexicon (Abridged ed.). United Kingdom: Oxford University Press
  •  Patouillard N. T. 1889. “Le genre Ganoderma” [The genus Ganoderma], Bulletin de la Société Mycologique de France
  • Arvind Bijalwan, KalpanaBahuguna, Amol Vasishth, Alankar Singh, Sumit Chaudhary, Anil Tyagi, MP Thakur, Tarun Kumar Thakur, Manmohan JR Dobriyal, Rajesh Kaushal, Arjun Singh, Nandini Maithani, Devendra Kumar, Gaurav Kothari, Pramod Kumar Chourasia. 2020. “Insights of medicinal mushroom (Ganoderma lucidum): prospects and potential in India”, Biodiversity International Journal
  • Martin P.A. Coetzee, Seonju Marincowitz, Vuledzani G. Muthelo and Michael J. Wingfield. 2015. “Ganoderma species, including new taxa associated with root rot of the iconic Jacaranda mimosifolia in Pretoria, South Africa”, International Mycological Association
  • Andrew L. Loyd, Brantlee S. Richter, Michelle A. Jusino, Camille Truong, Matthew E. Smith, Robert A. Blanchette and Jason A. Smith. 2018. “Identifying the “Mushroom of Immortality”: Assessing the Ganoderma Species Composition in Commercial Reishi Products”, Frontiers in Microbiology
  • Yu-Li Lin, Yu-Chih Liang, Yu-Shan Tseng, Hsin-Yi Huang, Shu-Yu Chou, Ruey-Shyang Hseu, Ching-Tsan Huang, Bor-Luen Chiang. 2009. “An immunomodulatory protein, Ling Zhi‐8, induced activation and maturation of human monocyte‐derived dendritic cells by the NF‐κB and MAPK pathways”, Journal of Leukocyte Biology
  • Kwok Yung, Kwok F. J., Li Carina C. F., Lam Clarence C. K., Man Ricky Y. K. 2005. “A Prospective, Randomized, Double-Blind, Placebo-Controlled Study of the Platelet and Global Hemostatic Effects of Ganoderma Lucidum (Ling-Zhi) in Healthy Volunteers”, Anesthesia & Analgesia
  • Dejan S Stojković , Lillian Barros, Ricardo C Calhelha, Jasmina Glamočlija, Ana Ćirić, Leo J L D van Griensven, Marina Soković, Isabel C F R Ferreira.  2014. “A detailed comparative study between chemical and bioactive properties of Ganoderma lucidum from different origins”, International Journal of Food and Nutrition

Fonti immagini

Condividi l'articolo di Microbiologia Italia:

Lascia un commento